Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5232

expand all nodes | collapse all nodes | view schema

Name Class

Expr5232Expression_of (2)
HomolHomol_homolCHROMOSOME_X:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (14)
TypeReporter_gene[C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
PatternAdult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail ;
RemarkStrain: BC14110
ReferenceWBPaper00006525
TransgeneWBTransgene00003405