WormBase Tree Display for Expr_pattern: Expr5217
expand all nodes | collapse all nodes | view schema
Expr5217 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C09E7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005300 | ||
WBbt:0005735 | |||
WBbt:0006749 | |||
Type | Reporter_gene | [oig-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTATTCCTTCTCCTGTTCCAA] 3' and primer B 5' [ACTCGGAGAAGATAGTCGAACG] 3'. | |
Pattern | Adult Expression: Nervous System; nerve ring; ventral nerve cord; | ||
Larval Expression: Nervous System; nerve ring; ventral nerve cord; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12431 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002925 |