Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5203

expand all nodes | collapse all nodes | view schema

Name Class

Expr5203Expression_ofGeneWBGene00015580
Reflects_endogenous_expression_ofWBGene00015580
HomolHomol_homolC07H6:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail ;
Picture (3)
RemarkAlso expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP.
Strain: BC12754
ReferenceWBPaper00006525
TransgeneWBTransgene00004488