WormBase Tree Display for Expr_pattern: Expr5203
expand all nodes | collapse all nodes | view schema
Expr5203 | Expression_of | Gene | WBGene00015580 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015580 | ||
Homol | Homol_homol | C07H6:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (13) | |||
Type | Reporter_gene | [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000003755 | ||
WBPicture0000003756 | |||
WBPicture0000009194 | |||
Remark | Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. | ||
Strain: BC12754 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004488 |