Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5185

expand all nodes | collapse all nodes | view schema

Name Class

Expr5185Expression_ofGeneWBGene00007363
Reflects_endogenous_expression_ofWBGene00007363
HomolHomol_homolC06B3:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'.
PatternAdult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
PictureWBPicture0000003725
RemarkAlso expressed in (comments from author) : This strain is an UNC.
Strain: BC12544
ReferenceWBPaper00006525
TransgeneWBTransgene00004262