Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5145

expand all nodes | collapse all nodes | view schema

Name Class

Expr5145Expression_ofGeneWBGene00007299
Reflects_endogenous_expression_ofWBGene00007299
HomolHomol_homolC04F12:Expr
Expression_data (2)
TypeReporter_gene[C04F12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCGGTTGCCTCTAATAGT] 3' and primer B 5' [GGTGTAGAAACCGGATCTGAAA] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons;
RemarkStrain: BC13645
ReferenceWBPaper00006525
TransgeneWBTransgene00003237