Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5136

expand all nodes | collapse all nodes | view schema

Name Class

Expr5136Expression_ofGeneWBGene00015404
Reflects_endogenous_expression_ofWBGene00015404
HomolHomol_homolC03H5:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (19)
TypeReporter_gene[C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC14237
ReferenceWBPaper00006525
TransgeneWBTransgene00003461