WormBase Tree Display for Expr_pattern: Expr5133
expand all nodes | collapse all nodes | view schema
Expr5133 | Expression_of | Gene | WBGene00015391 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015391 | ||
Homol | Homol_homol | D2021:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [C03G5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGGCTATCCAATGGTTTCT] 3' and primer B 5' [CGGCTCGGAGGATTTTTC] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : Adult and larval have expression in either the seam cells or H cell but it was difficult to determine. There is also occassional mosaic expression in the body wall muscle. | ||
Strain: BC10570 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002317 |