WormBase Tree Display for Expr_pattern: Expr5114
expand all nodes | collapse all nodes | view schema
Expr5114 | Expression_of | Gene | WBGene00015347 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015347 | ||
Homol | Homol_homol | C02F5:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006748 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [C02F5.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATACCACCAACCTCCATTCTTTT] 3' and primer B 5' [TGTGAAATCTGCGATCTGAAATA] 3'. | |
Pattern (2) | |||
Picture | WBPicture0000003630 | ||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC13988 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003358 |