WormBase Tree Display for Expr_pattern: Expr5104
expand all nodes | collapse all nodes | view schema
Expr5104 | Expression_of | Gene | WBGene00001953 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001953 | ||||
Homol | Homol_homol | C02B8:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005738 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [hlh-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGCTTTCAAAATCCCAAACA] 3' and primer B 5' [GCCACGATCTGTGAAAATCATA] 3'. | |||
Pattern | Adult Expression: intestine; | ||||
Larval Expression: intestine; unidentified cells in body ; | |||||
Remark | Also expressed in (comments from author) : There are two cells expressing GFP in the body. | ||||
Strain: BC12188 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002855 |