WormBase Tree Display for Expr_pattern: Expr5099
expand all nodes | collapse all nodes | view schema
Expr5099 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C01G8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0005319 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005767 | |||
WBbt:0005798 | |||
WBbt:0005799 | |||
WBbt:0005812 | |||
WBbt:0006751 | |||
WBbt:0006760 | |||
Type | Reporter_gene | [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'. | |
Pattern | Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; | ||
Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells; | |||
Picture | WBPicture0000003614 | ||
WBPicture0000003615 | |||
WBPicture0000003616 | |||
Remark | Also expressed in (comments from author) : quite a number of processes in head | ||
Strain: BC10874 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002409 |