WormBase Tree Display for Expr_pattern: Expr5093
expand all nodes | collapse all nodes | view schema
Expr5093 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | CHROMOSOME_I:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005394 | ||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0006751 | |||
WBbt:0006753 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [C01F4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTTGTGGGTTTATGAACGAGT] 3' and primer B 5' [TCGAGATTACCTGAACATTGAAAA] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; | ||
Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; | |||
Picture | WBPicture0000009122 | ||
WBPicture0000009123 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC14488 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004602 |