WormBase Tree Display for Expr_pattern: Expr5065
expand all nodes | collapse all nodes | view schema
Expr5065 | Expression_of | Gene | WBGene00015168 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015168 | ||
Homol | Homol_homol | B0403:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'. | |
Pattern | Adult Expression: pharyngeal gland cells; intestine; Nervous System; tail neurons; unidentified cells in tail ; | ||
Larval Expression: pharyngeal gland cells; intestine; body wall muscle; hypodermis; | |||
Picture | WBPicture0000003571 | ||
WBPicture0000003572 | |||
WBPicture0000003573 | |||
WBPicture0000003574 | |||
WBPicture0000003575 | |||
WBPicture0000003576 | |||
WBPicture0000003577 | |||
Remark | Also expressed in (comments from author) : Neural in tails is the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). | ||
Strain: BC13607 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003225 |