WormBase Tree Display for Expr_pattern: Expr5033
expand all nodes | collapse all nodes | view schema
Expr5033 | Expression_of | Gene | WBGene00015099 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00015099 | ||
Homol | Homol_homol | B0280:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [B0280.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGACTTTTGCAATAAAATCCGTTT] 3' and primer B 5' [TTTAGGTTGAAACCGTTGCC] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; tail neurons; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: intestine; Nervous System; tail neurons; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC10368 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002214 |