Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5033

expand all nodes | collapse all nodes | view schema

Name Class

Expr5033Expression_ofGeneWBGene00015099
Reflects_endogenous_expression_ofWBGene00015099
HomolHomol_homolB0280:Expr
Expression_data (2)
TypeReporter_gene[B0280.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGACTTTTGCAATAAAATCCGTTT] 3' and primer B 5' [TTTAGGTTGAAACCGTTGCC] 3'.
PatternAdult Expression: intestine; Nervous System; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; Nervous System; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC10368
ReferenceWBPaper00006525
TransgeneWBTransgene00002214