Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr2459

expand all nodes | collapse all nodes | view schema

Name Class

Expr2459Expression_ofGeneWBGene00004726
Reflects_endogenous_expression_ofWBGene00004726
Expression_data (3)
Subcellular_localizationIn newly fertilized embryos, SAS-4 is localized to a discrete spot near the sperm-derived pronucleus. At a slightly later stage, gamma-tubulin is recruited to the sperm centrioles forming a focus that colocalizes with SAS-4. As the embryo proceeds into mitosis, the amount of gamma-tubulin at centrosomes dramatically increases. In contrast, the SAS-4 staining remains unchanged as a small dot in the center of the centrosome.
TypeAntibodyImmunofluorescence of whole worms and fixed embryos. Affinity-purified polyclonal rabbit antibody against SAS-4 recombinant protein. 6xHis tagged full-length SAS-4 was prepared by amplifying the cDNA, yk425b11, using the following primers: CGCGCGGGATCCGCTTCCGATGAAAATATCGGTG and CGCGCGCTCGAGTCATTTTTTCCACTGGAACAAAGTT, digesting the product with BamHI/XhoI and cloning into pRSET-A (Invitrogen). Antibodies to the fusion protein were generated in rabbits and affinity purified.
PatternIn worms, SAS-4 colocalized with gamma-tubulin to centrosomes both in sperm and in the syncytial part of the gonad. SAS-4 staining in the gonad disappeared as the meiotic nuclei cellularized to form oocytes, presumably marking the point at which the centrioles are lost during oogenesis.
ReferenceWBPaper00005739
Antibody_infoWBAntibody00000606