WormBase Tree Display for Variation: WBVar02158467
expand all nodes | collapse all nodes | view schema
WBVar02158467 | Evidence | Person_evidence | WBPerson466 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ij109 | ||||||
Other_name | R08E5.3.1:c.400T>A | |||||||
CE12576:p.Tyr134Asn | ||||||||
HGVSg | CHROMOSOME_V:g.3773689T>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R08E5 | ||||
Flanking_sequences | ttcaggaaagacgggccacttggcctggag | ACGCGCAATTCACAAAATTCCAATATTTCA | ||||||
Mapping_target | R08E5 | |||||||
Type_of_mutation | Substitution | T | A | |||||
SeqStatus | Sequenced | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00052775 | |||||||
WBStrain00055595 | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019963 | ||||||
Transcript | R08E5.3.1 (12) | |||||||
Possibly_affects | WBGene00019963 | Paper_evidence | WBPaper00064568 | |||||
Remark | CGC_name rips-1 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | V | -7.99972 | |||||
Description | Phenotype | WBPhenotype:0001502 | Paper_evidence | WBPaper00064568 | ||||
Curator_confirmed | WBPerson466 | |||||||
Remark | Thiol reducing agent resistance; Resistant to DTT and 2-ME toxicity | Paper_evidence | WBPaper00064568 | |||||
Curator_confirmed | WBPerson466 | |||||||
Affected_by | Molecule | WBMol:00004908 | Paper_evidence | WBPaper00064568 | ||||
Curator_confirmed | WBPerson466 | |||||||
WBMol:00004258 | Paper_evidence | WBPaper00064568 | ||||||
Curator_confirmed | WBPerson466 | |||||||
Reference | WBPaper00064568 | |||||||
Remark | alt_det = c.400 T>A (Tac/Aac) mut_det = p.Y134N | Person_evidence | WBPerson466 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson466 on 2023-02-9_01:55:33 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
[2023-04-10T17:52:45.658Z WBPerson2987] New Variation: WBPaper00064568; allele of rips-1 | Curator_confirmed | WBPerson2987 | ||||||
Method | Substitution_allele |