WormBase Tree Display for Variation: WBVar02158267
expand all nodes | collapse all nodes | view schema
| WBVar02158267 | Evidence | Person_evidence | WBPerson2530 | ||
|---|---|---|---|---|---|
| Name | Public_name | kp23 | |||
| Other_name | CE08184:p.Gly20Glu | ||||
| C15H11.7.1:c.59G>A | |||||
| HGVSg | CHROMOSOME_V:g.14422560C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | C15H11 | |
| Flanking_sequences | aactattattttataacctgataaacacgt | cttctggagagaagatggtaatatgacgat | |||
| Mapping_target | C15H11 | ||||
| Type_of_mutation | Substitution | C | T | ||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00052710 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003922 | |||
| Transcript | C15H11.7.1 (12) | ||||
| Isolation | Mutagen | EMS | |||
| Forward_genetics | Genetic screen for enhancers of puf-8(-) phenotype | ||||
| Genetics | Interpolated_map_position | V | 6.30368 | ||
| Reference | WBPaper00053821 | ||||
| Remark | Variation information submitted by WBPerson2530 on 2022-11-1_05:22:07 via the Allele submission form. Submitted data refers to the negative strand. | Curator_confirmed | WBPerson51134 | ||
| Method | Substitution_allele |
