WormBase Tree Display for Variation: WBVar02157904
expand all nodes | collapse all nodes | view schema
WBVar02157904 | Evidence | Person_evidence | WBPerson47518 | ||
---|---|---|---|---|---|
Name | Public_name | db1239 | |||
Other_name | CE53054:p.Cys1957Tyr | ||||
F53B7.5b.1:c.5870G>A | |||||
HGVSg | CHROMOSOME_V:g.10974058C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F53B7 | |
Flanking_sequences | tgattgaaaaaaaacttacttgaaatcaaa | aagaagcagttgaatactgagtattttcgt | |||
Mapping_target | F53B7 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00052693 | ||||
Status | Live | ||||
Affects | Gene | WBGene00009968 | |||
Transcript | F53B7.5b.1 (12) | ||||
Possibly_affects | WBGene00009968 | Paper_evidence | WBPaper00062520 | ||
Remark | CGC_name fig-1 | ||||
Isolation | Mutagen | EMS | |||
Forward_genetics | aggregating mutant | ||||
Genetics | Interpolated_map_position | V | 2.87382 | ||
Description | Phenotype | WBPhenotype:0001820 | Paper_evidence | WBPaper00062520 | |
Curator_confirmed | WBPerson47518 | ||||
Reference | WBPaper00062520 | ||||
Remark | alt_det = C to T mut_det = C(1951)Y | Person_evidence | WBPerson47518 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson47518 on 2022-06-23_14:34:25 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
[2022-09-29T19:29:57.186Z WBPerson2987] New Variation: WBPaper00062520; allele of fig-1 | Curator_confirmed | WBPerson2987 | |||
Method | Substitution_allele |