WormBase Tree Display for Variation: WBVar02156678
expand all nodes | collapse all nodes | view schema
| WBVar02156678 | Name | Public_name | gk5849 | ||
|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.660242_663627del | ||||
| Sequence_details | SMap | S_parent | Sequence | Y65B4A | |
| Flanking_sequences | GACGGTCCACGTTTCGGCGAGCGTTTTGTG | CGGCTGCGCGTCTCTATTTCACACACTGTC | |||
| Mapping_target | CHROMOSOME_I | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Pending_curation | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00051447 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00022031 | |||
| Transcript | Y65B4A.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
| VEP_impact | HIGH | ||||
| cDNA_position | ?-1210 | ||||
| CDS_position | ?-1149 | ||||
| Protein_position | ?-383 | ||||
| Intron_number | 2-5/6 | ||||
| Exon_number | 1-6/7 | ||||
| Isolation | Mutagen | CRISPR_Cas9 | |||
| Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
| Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced. | |||||
| Method | Allele |
