WormBase Tree Display for Variation: WBVar02156455
expand all nodes | collapse all nodes | view schema
WBVar02156455 | Name | Public_name | gk5610 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.10178807_10179239del | ||||
Sequence_details | SMap | S_parent | Sequence | C25A1 | |
Flanking_sequences | AGCTACTCAGCACGTGCCTATTATCCTCAC | GCTGGTTTGGGAGTGGCGCCGCATGTTGCG | |||
Mapping_target | CHROMOSOME_I | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051227 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene (3) | ||||
Transcript | C25A1.6.1 | VEP_consequence | transcript_ablation | ||
VEP_impact | HIGH | ||||
Exon_number | 1/1 | ||||
C25A1.16a.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | ?-222 | ||||
CDS_position | ?-2 | ||||
Protein_position | ?-1 | ||||
Exon_number | 1-2/5 | ||||
C25A1.5.1 | VEP_consequence | 3_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | 1192-? | ||||
Exon_number | 8/8 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Allele |