WormBase Tree Display for Variation: WBVar02156424

WBVar02156424 Name: Public_name: gk5577
    HGVSg: CHROMOSOME_X:g.6205296_6206462del
  Sequence_details: SMap: S_parent: Sequence: T13C5
    Flanking_sequences: ATCTAAAAACAAACATGAATTCTACTCTTT AAAGGTGAAAAACCATGCAGAGAAGAGAAC
    Mapping_target: CHROMOSOME_X
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00051197
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00020486
      WBGene00077690
    Transcript: T13C5.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-492
        CDS_position: ?-492
        Protein_position: ?-164
        Intron_number: 1-2/3
        Exon_number: 1-3/4
      T13C5.6.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 776-?
        Exon_number: 9/9
  Isolation: Mutagen: CRISPR_Cas9
  Remark: Variation accession generated for Mark Edgley for a set of gk CRISPR alleles.
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced.
  Method: Allele