WormBase Tree Display for Variation: WBVar02156340
expand all nodes | collapse all nodes | view schema
| WBVar02156340 | Name | Public_name | gk5235 | ||
|---|---|---|---|---|---|
| Other_name | F28D1.10.1:c.243_2402del | ||||
| CE05750:p.Thr82_Ter801delextTer? | |||||
| HGVSg | CHROMOSOME_IV:g.12404773_12407318del | ||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | |
| Flanking_sequences | GTCGACGTTCGAATATGTACAAGAAAAGTC | TGCTTCATCTGGTCATATGGTTTGGAGTGA | |||
| Mapping_target | CHROMOSOME_IV | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Pending_curation | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00051117 | ||||
| Laboratory | VC | ||||
| Person | WBPerson427 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00001580 | |||
| Transcript | F28D1.10.1 (11) | ||||
| Isolation | Mutagen | CRISPR_Cas9 | |||
| Remark | Variation accession generated for Mark Edgley for a set of gk CRISPR alleles. | ||||
| Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
| Method | Allele |
