WormBase Tree Display for Variation: WBVar02154211
expand all nodes | collapse all nodes | view schema
WBVar02154211 | Evidence | Curator_confirmed | WBPerson1983 | ||
---|---|---|---|---|---|
Name | Public_name | ve653 | |||
Other_name | T20B3.2.1:c.-18_*4del | ||||
T20B3.7.1:c.208+259_208+1604del | |||||
T20B3.7.2:c.208+259_208+1604del | |||||
HGVSg | CHROMOSOME_V:g.16833782_16835127del | ||||
Sequence_details | SMap | S_parent | Sequence | T20B3 | |
Flanking_sequences | agcacataaaaatctacaaaaagatcacca | cctggaaaagttgatctgtgagaagtggca | |||
Mapping_target | T20B3 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Engineered_allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00049392 | ||||
Production_method | CRISPR_Cas9 | ||||
Status | Live | ||||
Affects | Gene | WBGene00006585 | |||
WBGene00004026 | |||||
Transcript | T20B3.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,stop_retained_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | T20B3.2.1:c.-18_*4del | ||||
cDNA_position | 2-806 | ||||
Intron_number | 2-4/5 | ||||
Exon_number | 1-6/6 | ||||
T20B3.7.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T20B3.7.1:c.208+259_208+1604del | ||||
Intron_number | 3/7 | ||||
T20B3.7.2 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | T20B3.7.2:c.208+259_208+1604del | ||||
Intron_number | 2/6 | ||||
Remark | Whole gene deletions made by the Rougvie, Moerman, Hutter and Sternberg labs that replace the coding sequence with a [LoxP + myo-2p::GFP::unc-54 3Prime UTR + rps-27p::neoR::unc-54 3Prime UTR + LoxP] cassette. | ||||
Allele Description:tni-3(ve653[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | |||||
sgRNA1:GGAGGAAGAGGAATAAgaag sgRNA2: tttggcggggaaaaatgacc | |||||
Method | Engineered_allele |