WormBase Tree Display for Variation: WBVar02153673

WBVar02153673 Name: Public_name: gk5312
    Other_name: R09H10.4.1:c.181+105_2336del
    HGVSg: CHROMOSOME_IV:g.10617379_10620107del
  Sequence_details: SMap: S_parent: Sequence: R09H10
    Flanking_sequences: TGCAGAAGACTGTGGCTAAATGTTTCTAAT CGCTATAGGATTTCCACTTTTACAATGTGG
    Mapping_target: CHROMOSOME_IV
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00047593
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004228
    Transcript: R09H10.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R09H10.4.1:c.181+105_2336del
        cDNA_position: ?-2410
        CDS_position: ?-2336
        Protein_position: ?-779
        Intron_number: 3-9/11
        Exon_number: 4-10/12
  Isolation: Mutagen: CRISPR_Cas9
  Genetics: Interpolated_map_position: IV 4.64154
  Remark: Batch created from Strain genotype data Curator_confirmed: WBPerson1983
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced.
  Method: Deletion_allele