WormBase Tree Display for Variation: WBVar02153632
expand all nodes | collapse all nodes | view schema
WBVar02153632 | Name | Public_name | gk5148 | ||
---|---|---|---|---|---|
Other_name | F59C12.1a.1:c.271-85_1786del | ||||
F59C12.1b.1:c.271-85_*33del | |||||
HGVSg | CHROMOSOME_X:g.16597412_16601826del | ||||
Sequence_details | SMap | S_parent | Sequence | F59C12 | |
Flanking_sequences | TGACTTGTTACATTGAATTCTGAAGGTAGT | CACCGGGTCCCAAAAGATCACAAGGTGCCC | |||
Mapping_target | CHROMOSOME_X | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037905 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000401 | |||
Transcript | F59C12.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F59C12.1a.1:c.271-85_1786del | ||||
cDNA_position | ?-1788 | ||||
CDS_position | ?-1786 | ||||
Protein_position | ?-596 | ||||
Intron_number | 3-14/15 | ||||
Exon_number | 4-15/16 | ||||
F59C12.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F59C12.1b.1:c.271-85_*33del | ||||
cDNA_position | ?-1800 | ||||
Intron_number | 3-14/15 | ||||
Exon_number | 4-16/16 | ||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | X | 24.056 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Deletion_allele |