WormBase Tree Display for Variation: WBVar02153235

WBVar02153235 Name: Public_name: kb24
    Other_name: F47G4.3.1:c.690+317_843del
    HGVSg: CHROMOSOME_I:g.14076941_14077703del
  Sequence_details: SMap: S_parent: Sequence: F47G4
    Flanking_sequences: tgataataatgattcctccaaaaaatttag ggagtggctgatctcattaccacttgctat
    Mapping_target: F47G4
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00048030
    Laboratory: VP
    Status: Live
  Affects: Gene: WBGene00009824
    Transcript: F47G4.3.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F47G4.3.1:c.690+317_843del
        cDNA_position: ?-883
        CDS_position: ?-843
        Protein_position: ?-281
        Intron_number: 3/5
        Exon_number: 4/6
  Isolation: Mutagen: ENU
  Genetics: Interpolated_map_position: I 23.0183
  Reference: WBPaper00040945
    WBPaper00053771
  Remark: Note that this allele was generated in the lab of Kevin Strange, who is now retired. The Strange lab published with it in 2012 (PMID 22470531) and my lab in 2018 (PMID 29487136), but the allele details were not included. I wanted to report the details for others to benefit.
    Details provided: alt_det = deletion mut_det = deletion
  Method: Deletion_allele