WormBase Tree Display for Variation: WBVar02151823
expand all nodes | collapse all nodes | view schema
WBVar02151823 | Name | Public_name | tm11491 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | F13B9 | ||||
Flanking_sequences | gaaaatacggtagttaaagcattttatcca | cacacaaaatgttatcgatcccgttccgac | ||||||
Mapping_target | F13B9 | |||||||
Source_location | 7 | CHROMOSOME_X | 8268214 | 8292487 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11491_external | |||||||
tm11491_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11491 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017421 | ||||||
WBGene00017420 | ||||||||
WBGene00002239 | ||||||||
WBGene00200562 | ||||||||
WBGene00001425 | ||||||||
WBGene00197097 | ||||||||
WBGene00305353 | ||||||||
WBGene00017419 | ||||||||
Transcript (13) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Remark | 6094/6095-30366/30367 (24272 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |