WormBase Tree Display for Variation: WBVar02151541

WBVar02151541 Name: Public_name: tm11199
    HGVSg: CHROMOSOME_IV:g.7497321_7502365del
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: tccattttgtaagcacggttgcggcgagca atgatttttatttgccgtttcaagaacagc
    Mapping_target: CHROMOSOME_IV
    Source_location: 7 CHROMOSOME_IV 7497320 7502366 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11199_external
      tm11199_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11199
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006967
      WBGene00018906
      WBGene00201427
      WBGene00018907
    Transcript: F55G1.16
      F55G1.15.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2-12/13
        Exon_number: 1-14/14
      F55G1.20 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      F55G1.13.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-309
        CDS_position: ?-300
        Protein_position: ?-100
        Intron_number: 2-3/19
        Exon_number: 1-4/20
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: [F55G1]33146/33147-[R05G6]1037/1038 (5045 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F55G1 updated based on the VEP analysis pipeline to CHROMOSOME_IV.
  Method: NBP_knockout_allele