WormBase Tree Display for Variation: WBVar02151120

WBVar02151120 Name: Public_name: tm10757
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: ttcgagtgtttttttttgtaaaaacttaaa attttgatgtttacaaggcccagatcaaaa
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 14590167 14622154 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10757_external
      tm10757_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10757
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002978
      WBGene00044265
      WBGene00013682
    Transcript (22)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Remark: [Y105E8A]257007/257008-[Y105E8B]11491/11492 (31986 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y105E8A updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele