WormBase Tree Display for Variation: WBVar02151026

WBVar02151026 Name: Public_name: tm6906
    HGVSg: CHROMOSOME_I:g.3481956_3483181del
  Sequence_details: SMap: S_parent: Sequence: Y47G6A
    Flanking_sequences: gctgtaattcgtttcctacccccgttttcc cgtaaaatgcctattttattataaacgcgc
    Mapping_target: Y47G6A
    Source_location: 7 CHROMOSOME_I 3481955 3483182 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6906_external
      tm6906_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6906
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000794
    Transcript: Y47G6A.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/5
        Exon_number: 1-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Remark: 49361/49362-50587/50588 (1226 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele