WormBase Tree Display for Variation: WBVar02150488

WBVar02150488 Name: Public_name: tm12983
    HGVSg: CHROMOSOME_V:g.9110959_9111060delinsTTTAAACTTTCAGAACA
  Sequence_details: SMap: S_parent: Sequence: F21C10
    Flanking_sequences: gaagaaagaagtaataatgttgatgctcat tttttaaactttcagaacacaaatgcaaat
    Mapping_target: F21C10
    Source_location: 7 CHROMOSOME_V 9110958 9111061 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTAAACTTTCAGAACA
      Deletion
    PCR_product: tm12983_external
      tm12983_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12983
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004119
    Transcript: F21C10.8a.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1173-?
        Exon_number: 6/6
      F21C10.8b.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1164-?
        Exon_number: 6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 16419/16420-TTTAAACTTTCAGAACA-16521/16522(102 bp deletion + 17 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele