WormBase Tree Display for Variation: WBVar02148683
expand all nodes | collapse all nodes | view schema
| WBVar02148683 | Evidence | Person_evidence | WBPerson18836 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | qt103 | |||||
| Other_name | C04F5.1.1:c.1391G>A | ||||||
| CE30331:p.Cys464Tyr | |||||||
| HGVSg | CHROMOSOME_V:g.5123733G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | C04F5 | |||
| Flanking_sequences | CATCTACAATGGCAAATCGCGACGAAATGT | CTTCCACAATCATGCGTGTGCTCGGCCATT | |||||
| Mapping_target | C04F5 | ||||||
| Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson18836 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00008358 | ||||||
| Laboratory | HC | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004795 | |||||
| Transcript | C04F5.1.1 (12) | ||||||
| Isolation | Mutagen | EMS | Person_evidence | WBPerson18836 | |||
| Forward_genetics | Phenotypic_screen_(Sid) | ||||||
| Genetics | Interpolated_map_position | V | -2.49473 | ||||
| Remark | Reported to affect: sid-1, Mutation Details: C(464)Y, Type of Mutation:Missense | ||||||
| Method | Substitution_allele |
