WormBase Tree Display for Variation: WBVar02148071

WBVar02148071 Name: Public_name: tm10297
    HGVSg: CHROMOSOME_V:g.15175732_15175816del
  Sequence_details: SMap: S_parent: Sequence: T09F5
    Flanking_sequences: tatcaaaactctatagtatataagactatg cttcaatttcgtgtccaagtggctttacac
    Mapping_target: T09F5
    Source_location: 7 CHROMOSOME_V 15175731 15175817 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10297_external
      tm10297_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10297
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011668
    Transcript: T09F5.9.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-58
        CDS_position: ?-55
        Protein_position: ?-19
        Exon_number: 1-2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 29944/29945-30029/30030 (85 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele