WormBase Tree Display for Variation: WBVar02147420
expand all nodes | collapse all nodes | view schema
WBVar02147420 | Evidence | Paper_evidence | WBPaper00046863 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | et26 | |||||||
Other_name | CE38576:p.Gln137Ter | ||||||||
CE32033:p.Gln137Ter | |||||||||
ZC376.7b.2:c.409C>T | |||||||||
CE15205:p.Gln153Ter | |||||||||
ZC376.7c.2:c.409C>T | |||||||||
ZC376.7a.1:c.457C>T | |||||||||
ZC376.7c.1:c.409C>T | |||||||||
ZC376.7b.1:c.409C>T | |||||||||
ZC376.7a.2:c.457C>T | |||||||||
HGVSg | CHROMOSOME_V:g.14195042C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC376 | |||||
Flanking_sequences | agcagtgttggacatccacatggtcatcag | aacaacagcagacatgtcagcagccgccca | |||||||
Mapping_target | ZC376 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00046863 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | QC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013878 | |||||||
Transcript | ZC376.7c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7c.1:c.409C>T | ||||||||
HGVSp | CE38576:p.Gln137Ter | ||||||||
cDNA_position | 446 | ||||||||
CDS_position | 409 | ||||||||
Protein_position | 137 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC376.7a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7a.2:c.457C>T | ||||||||
HGVSp | CE15205:p.Gln153Ter | ||||||||
cDNA_position | 627 | ||||||||
CDS_position | 457 | ||||||||
Protein_position | 153 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC376.7b.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7b.2:c.409C>T | ||||||||
HGVSp | CE32033:p.Gln137Ter | ||||||||
cDNA_position | 583 | ||||||||
CDS_position | 409 | ||||||||
Protein_position | 137 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC376.7a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7a.1:c.457C>T | ||||||||
HGVSp | CE15205:p.Gln153Ter | ||||||||
cDNA_position | 494 | ||||||||
CDS_position | 457 | ||||||||
Protein_position | 153 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC376.7c.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7c.2:c.409C>T | ||||||||
HGVSp | CE38576:p.Gln137Ter | ||||||||
cDNA_position | 559 | ||||||||
CDS_position | 409 | ||||||||
Protein_position | 137 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC376.7b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC376.7b.1:c.409C>T | ||||||||
HGVSp | CE32033:p.Gln137Ter | ||||||||
cDNA_position | 446 | ||||||||
CDS_position | 409 | ||||||||
Protein_position | 137 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000537439 | ||||||||
Genetics | Interpolated_map_position | V | 6.19623 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | atfs-1(et26) did not affect expression of the hsp-60::GFP transgene (Figure 5C) | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00046863 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hsp-60::GFP | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00046863 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Ten of these mutants were characterized in some detail. All were growth-inhibited by 0.5 mM fluvastatin, to which the atfs-1(et15) allele is resistant, and all harbored mutations within the coding region of atfs-1 (Figure 5, D and E)." | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00046863 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00046863 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00046863 | ||||||||
Method | Substitution_allele |