WormBase Tree Display for Variation: WBVar02146904
expand all nodes | collapse all nodes | view schema
WBVar02146904 | Name | Public_name | tm5974 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C56A3.7a.1:c.672+155_*112del | |||||||
HGVSg | CHROMOSOME_V:g.13559027_13559913del | |||||||
Sequence_details | SMap | S_parent | Sequence | C56A3 | ||||
Flanking_sequences | aatttccagttgaattgttgaaaaaaattg | gatagcatcaaacgctgtacagtcttatat | ||||||
Mapping_target | C56A3 | |||||||
Source_location | 7 | CHROMOSOME_V | 13559026 | 13559914 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm5974_external | |||||||
tm5974_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 5974 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000302 | ||||||
Transcript | C56A3.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C56A3.7a.1:c.672+155_*112del | |||||||
cDNA_position | ?-1224 | |||||||
Intron_number | 8-10/11 | |||||||
Exon_number | 9-12/12 | |||||||
C56A3.7d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 5-7/7 | |||||||
Exon_number | 6-8/8 | |||||||
C56A3.7b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 6-8/8 | |||||||
Exon_number | 7-9/9 | |||||||
C56A3.7c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/3 | |||||||
Exon_number | 2-4/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Remark | 32692/32693-33579/33580 (887 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |