WormBase Tree Display for Variation: WBVar02146758

WBVar02146758 Name: Public_name: tm8497
    Other_name: CE13537:p.Glu95AspfsTer31
      T09F5.9.1:c.285_384del
    HGVSg: CHROMOSOME_V:g.15176046_15176191del
  Sequence_details: SMap: S_parent: Sequence: T09F5
    Flanking_sequences: caattattggctcggactcaagtgctcaga tttgttgagacagcagggaatagtgctgga
    Mapping_target: T09F5
    Source_location: 7 CHROMOSOME_V 15176045 15176192 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm8497_external
      tm8497_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8497
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011668
    Transcript: T09F5.9.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 30258/30259-30404/30405 (146 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele