WormBase Tree Display for Variation: WBVar02146132

WBVar02146132 Name: Public_name: tm8129
  Sequence_details: SMap: S_parent: Sequence: Y105C5A
    Flanking_sequences: gattctttataccagactgtgccatccgaa tttgtttttaacaaagagatcatatatact
    Mapping_target: Y105C5A
    Source_location: 7 CHROMOSOME_IV 15661844 15661928 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAG
      Deletion
    PCR_product: tm8129_external
      tm8129_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 8129
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00050374
    Transcript: Y105C5A.471
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 112855/112856-AAG-112938/112939 (83 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele