WormBase Tree Display for Variation: WBVar02145299
expand all nodes | collapse all nodes | view schema
| WBVar02145299 | Evidence | Paper_evidence | WBPaper00048723 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | av41 | |||||
| Other_name | CE38132:p.Pro17Ter | ||||||
| ZK265.9.1:c.49_50delinsTA | |||||||
| HGVSg | CHROMOSOME_I:g.8254823_8254824delinsTA | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK265 | |||
| Flanking_sequences | tgatttttcagagactccacaacaaagcga | agcttccccaaatagcacgccgaatgctgc | |||||
| Mapping_target | ZK265 | ||||||
| Type_of_mutation | Substitution | cc | ta | Paper_evidence | WBPaper00048723 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Engineered_allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | AG | ||||||
| Production_method | CRISPR_Cas9 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00044094 | |||||
| Transcript | ZK265.9.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | ZK265.9.1:c.49_50delinsTA | ||||||
| HGVSp | CE38132:p.Pro17Ter | ||||||
| cDNA_position | 55-56 | ||||||
| CDS_position | 49-50 | ||||||
| Protein_position | 17 | ||||||
| Exon_number | 3/9 | ||||||
| Codon_change | CCa/TAa | ||||||
| Amino_acid_change | P/* | ||||||
| Description | Phenotype | WBPhenotype:0000060 | Paper_evidence | WBPaper00048723 | |||
| Curator_confirmed | WBPerson205 | ||||||
| Remark | Homozygotes die as young adults or sire very small broods that arrest as L1s and L2s. | Paper_evidence | WBPaper00048723 | ||||
| Curator_confirmed | WBPerson205 | ||||||
| WBPhenotype:0000447 | Paper_evidence | WBPaper00048723 | |||||
| Curator_confirmed | WBPerson205 | ||||||
| Remark | Homozygotes die as young adults or sire very small broods that arrest as L1s and L2s. | Paper_evidence | WBPaper00048723 | ||||
| Curator_confirmed | WBPerson205 | ||||||
| WBPhenotype:0001804 | Paper_evidence | WBPaper00048723 | |||||
| Curator_confirmed | WBPerson205 | ||||||
| Remark | fewer and smaller lipid droplets | Paper_evidence | WBPaper00048723 | ||||
| Curator_confirmed | WBPerson205 | ||||||
| WBPhenotype:0002279 | Paper_evidence | WBPaper00048723 | |||||
| Curator_confirmed | WBPerson205 | ||||||
| Remark | fewer and smaller lipid droplets | Paper_evidence | WBPaper00048723 | ||||
| Curator_confirmed | WBPerson205 | ||||||
| Reference | WBPaper00048723 | ||||||
| Remark | In addition to the Pro(17)Ochre mutation described av41 also carries a Pro(20)Ochre mutation | Paper_evidence | WBPaper00048723 | ||||
| Method | Engineered_allele |
