WormBase Tree Display for Variation: WBVar02145216
expand all nodes | collapse all nodes | view schema
WBVar02145216 | Name | Public_name | tm8047 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F31B12.1k.1:c.1957+28_2061del | |||||||
F31B12.1d.1:c.1957+28_2061del | ||||||||
F31B12.1l.1:c.1786+28_1890del | ||||||||
F31B12.1i.1:c.1957+28_2061del | ||||||||
F31B12.1g.1:c.1786+28_1890del | ||||||||
F31B12.1j.1:c.1786+28_1890del | ||||||||
F31B12.1h.1:c.1786+28_1890del | ||||||||
HGVSg | CHROMOSOME_X:g.10824588_10824735del | |||||||
Sequence_details | SMap | S_parent | Sequence | F31B12 | ||||
Flanking_sequences | tagcaataatctggccaccaatatctgtgt | ttgcaagcaagcaaacaacacacaaaccct | ||||||
Mapping_target | F31B12 | |||||||
Source_location | 7 | CHROMOSOME_X | 10824587 | 10824736 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm8047_external | |||||||
tm8047_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 8047 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004036 | ||||||
Transcript | F31B12.1j.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1j.1:c.1786+28_1890del | |||||||
cDNA_position | ?-1890 | |||||||
CDS_position | ?-1890 | |||||||
Protein_position | ?-630 | |||||||
Intron_number | 17/63 | |||||||
Exon_number | 18/64 | |||||||
F31B12.1g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1g.1:c.1786+28_1890del | |||||||
cDNA_position | ?-1890 | |||||||
CDS_position | ?-1890 | |||||||
Protein_position | ?-630 | |||||||
Intron_number | 17/63 | |||||||
Exon_number | 18/64 | |||||||
F31B12.1d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1d.1:c.1957+28_2061del | |||||||
cDNA_position | ?-2061 | |||||||
CDS_position | ?-2061 | |||||||
Protein_position | ?-687 | |||||||
Intron_number | 18/64 | |||||||
Exon_number | 19/65 | |||||||
F31B12.1h.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1h.1:c.1786+28_1890del | |||||||
cDNA_position | ?-1890 | |||||||
CDS_position | ?-1890 | |||||||
Protein_position | ?-630 | |||||||
Intron_number | 17/63 | |||||||
Exon_number | 18/64 | |||||||
F31B12.1l.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1l.1:c.1786+28_1890del | |||||||
cDNA_position | ?-1890 | |||||||
CDS_position | ?-1890 | |||||||
Protein_position | ?-630 | |||||||
Intron_number | 17/63 | |||||||
Exon_number | 18/64 | |||||||
F31B12.1i.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1i.1:c.1957+28_2061del | |||||||
cDNA_position | ?-2061 | |||||||
CDS_position | ?-2061 | |||||||
Protein_position | ?-687 | |||||||
Intron_number | 18/64 | |||||||
Exon_number | 19/65 | |||||||
F31B12.1k.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F31B12.1k.1:c.1957+28_2061del | |||||||
cDNA_position | ?-2061 | |||||||
CDS_position | ?-2061 | |||||||
Protein_position | ?-687 | |||||||
Intron_number | 18/64 | |||||||
Exon_number | 19/65 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 28086/28087-28234/28235 (148 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |