WormBase Tree Display for Variation: WBVar02144852
expand all nodes | collapse all nodes | view schema
WBVar02144852 | Evidence | Paper_evidence | WBPaper00047026 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | tr355 | |||||
Other_name | CE50785:p.Arg7Lys | ||||||
T07C4.7a.1:c.221G>A | |||||||
T07C4.7b.1:c.20G>A | |||||||
CE00598:p.Arg74Lys | |||||||
HGVSg | CHROMOSOME_III:g.10334609G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||
Flanking_sequences | aattgacctggatgctctccggattccata | aatcagcggttgtgtaatggccggaaccct | |||||
Mapping_target | T07C4 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00047026 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033427 | ||||||
Laboratory | RP | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003225 | |||||
Transcript | T07C4.7b.1 (12) | ||||||
T07C4.7a.1 (12) | |||||||
Genetics | Interpolated_map_position | III | 2.346 | ||||
Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00047026 | |||
Curator_confirmed | WBPerson14226 | ||||||
Remark | Animals are resistant to the growth defects induced by the mitochondrial complex II inhibitor wact-12. | Paper_evidence | WBPaper00047026 | ||||
Curator_confirmed | WBPerson14226 | ||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00047026 | ||||
Curator_confirmed | WBPerson14226 | ||||||
Reference | WBPaper00047026 | ||||||
Method | Substitution_allele |