WormBase Tree Display for Variation: WBVar02144850
expand all nodes | collapse all nodes | view schema
| WBVar02144850 | Evidence | Paper_evidence | WBPaper00047026 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | tr386 | |||||
| Other_name | T07C4.7a.1:c.197C>T | ||||||
| CE00598:p.Thr66Ile | |||||||
| HGVSg | CHROMOSOME_III:g.10334585C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | T07C4 | |||
| Flanking_sequences | cacatctcaccgtctaccagccacaattga | ctggatgctctccggattccatagaatcag | |||||
| Mapping_target | T07C4 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00047026 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00033432 | ||||||
| Laboratory | RP | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003225 | |||||
| Transcript | T07C4.7a.1 (12) | ||||||
| Genetics | Interpolated_map_position | III | 2.34558 | ||||
| Description | Phenotype | WBPhenotype:0000011 | Paper_evidence | WBPaper00047026 | |||
| Curator_confirmed | WBPerson14226 | ||||||
| Remark | Animals are resistant to the growth defects induced by the mitochondrial complex II inhibitor wact-11. | Paper_evidence | WBPaper00047026 | ||||
| Curator_confirmed | WBPerson14226 | ||||||
| Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00047026 | ||||
| Curator_confirmed | WBPerson14226 | ||||||
| Reference | WBPaper00047026 | ||||||
| Method | Substitution_allele |
