WormBase Tree Display for Variation: WBVar02143995

WBVar02143995 Name: Public_name: tm7407
    HGVSg: CHROMOSOME_IV:g.3439454_3440149del
  Sequence_details: SMap: S_parent: Sequence: W05E7
    Flanking_sequences: agataccgacgattctttcaaaaatactcc gatatcaacagctccagagaaaagtacttc
    Mapping_target: W05E7
    Source_location: 7 CHROMOSOME_IV 3439453 3440150 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7407_external
      tm7407_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7407
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001702
      WBGene00001692
    Transcript: W05E7.3.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 558-?
        Exon_number: 5/5
      W05E7.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-387
        CDS_position: ?-363
        Protein_position: ?-121
        Intron_number: 2-3/4
        Exon_number: 1-4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 5715/5716-6411/6412 (696 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele