WormBase Tree Display for Variation: WBVar02141171

WBVar02141171 Name: Public_name: tm6868
    Other_name: T19B10.11.1:c.44_*69delinsCC
    HGVSg: CHROMOSOME_V:g.11244882_11245912delinsCC
  Sequence_details: SMap: S_parent: Sequence: T19B10
    Flanking_sequences: gtgacctcgaagatgaccagacaggtcact aaatgtttgcattttatcctgactttgcac
    Mapping_target: T19B10
    Source_location: 7 CHROMOSOME_V 11244881 11245913 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CC
      Deletion
    PCR_product: tm6868_external
      tm6868_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6868
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003509
    Transcript: T19B10.11.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T19B10.11.1:c.44_*69delinsCC
        cDNA_position: 44-444
        CDS_position: 44-?
        Protein_position: 15-?
        Intron_number: 1/2
        Exon_number: 1-3/3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 26697/26698-CC-27728/27729 (1031 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele