WormBase Tree Display for Variation: WBVar02125182
expand all nodes | collapse all nodes | view schema
WBVar02125182 | Name | Public_name | tm6526 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F16H6.1.1:c.368-35_1152del | |||||||
HGVSg | CHROMOSOME_V:g.18192679_18193603del | |||||||
Sequence_details | SMap | S_parent | Sequence | F16H6 | ||||
Flanking_sequences | aactggaaaataaaatctttgaattcttgt | cagtggtacacatcgacaacaaatacgatg | ||||||
Mapping_target | F16H6 | |||||||
Source_location | 7 | CHROMOSOME_V | 18192678 | 18193604 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6526 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008891 | ||||||
Transcript | F16H6.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F16H6.1.1:c.368-35_1152del | |||||||
cDNA_position | ?-1183 | |||||||
CDS_position | ?-1152 | |||||||
Protein_position | ?-384 | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 3-4/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 3015/3016-3940/3941 (925 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |