WormBase Tree Display for Variation: WBVar02125062
expand all nodes | collapse all nodes | view schema
WBVar02125062 | Evidence | Paper_evidence | WBPaper00044247 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | et9 | |||||
Other_name | CE30937:p.Cys211Tyr | ||||||
CE39144:p.Cys203Tyr | |||||||
F08C6.2a.1:c.632G>A | |||||||
F08C6.2b.1:c.608G>A | |||||||
HGVSg | CHROMOSOME_X:g.7579691G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F08C6 | |||
Flanking_sequences | ctgaaggtgtctctacaagtgacgtcgtct | cagaatcatccgtgattacgataagtacgt | |||||
Mapping_target | F08C6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00044247 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00031168 | ||||||
Laboratory | QC | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00017241 | |||||
Transcript | F08C6.2a.1 (12) | ||||||
F08C6.2b.1 (12) | |||||||
Interactor | WBInteraction000535504 | ||||||
Genetics | Interpolated_map_position | X | -1.48919 | ||||
Description | Phenotype | WBPhenotype:0000073 | Paper_evidence | WBPaper00044247 | |||
Curator_confirmed | WBPerson488 | ||||||
Remark | Suppressor of paqr-2 cold sensitivity and tail tip defect. | Paper_evidence | WBPaper00044247 | ||||
Curator_confirmed | WBPerson488 | ||||||
WBPhenotype:0000146 | Paper_evidence | WBPaper00044247 | |||||
Curator_confirmed | WBPerson488 | ||||||
Remark | Suppressor of paqr-2 cold sensitivity and tail tip defect. | Paper_evidence | WBPaper00044247 | ||||
Curator_confirmed | WBPerson488 | ||||||
Reference | WBPaper00044247 | ||||||
Method | Substitution_allele |