WormBase Tree Display for Variation: WBVar02124978
expand all nodes | collapse all nodes | view schema
WBVar02124978 | Name | Public_name | WBVar02124978 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855901 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | ||||
Flanking_sequences | ATTTTCTTATTCTTAAAACCAACATTTCGA | CTTGCAAAACAATCAAGATTTGCAGGACAC | ||||||
Mapping_target | Y60A3A | |||||||
Source_location | 225 | CHROMOSOME_V | 19921001 | 19932000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031113 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00013364 | ||||||
WBGene00004810 | ||||||||
WBGene00014934 | ||||||||
WBGene00013362 | ||||||||
WBGene00013363 | ||||||||
Transcript | Y60A3A.14.1 | |||||||
Y60A3A.16.1 | ||||||||
Y60A3A.18.1 | ||||||||
Y60A3A.16.2 | ||||||||
Pseudogene (2) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |