WormBase Tree Display for Variation: WBVar02124947
expand all nodes | collapse all nodes | view schema
WBVar02124947 | Name | Public_name | WBVar02124947 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855870 | |||||||
Sequence_details | SMap | S_parent | Sequence | R06B9 | ||||
Flanking_sequences | TTCGAAAAATTTCAAAATGTTCGAAAAAAATCTTTAAAAATTCGAAAAATTCGACGAAACAGTAAAAAAA | TGCCGGAGTAACCATTTTTTGAGCACATGT | ||||||
Mapping_target | R06B9 | |||||||
Source_location | 225 | CHROMOSOME_II | 13749001 | 13766000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031113 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00011054 | ||||||
WBGene00011055 | ||||||||
WBGene00011052 | ||||||||
WBGene00003246 | ||||||||
Transcript | R06B9.3.1 | |||||||
R06B9.1.1 | ||||||||
R06B9.4.1 | ||||||||
R06B9.3.2 | ||||||||
R06B9.6.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |