WormBase Tree Display for Variation: WBVar02124823
expand all nodes | collapse all nodes | view schema
WBVar02124823 | Name | Public_name | WBVar02124823 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855746 | |||||||
Sequence_details | SMap | S_parent | Sequence | C54D10 | ||||
Flanking_sequences | CCTTGAGAACATCGCAAAAATCTTTCAAAA | TTAATGTTGAATGTTTGGATTATTATGCTA | ||||||
Mapping_target | C54D10 | |||||||
Source_location | 225 | CHROMOSOME_V | 12427001 | 12446000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027648 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00008300 | ||||||
WBGene00008301 | ||||||||
WBGene00138721 | ||||||||
WBGene00045400 | ||||||||
WBGene00005249 | ||||||||
WBGene00195442 | ||||||||
WBGene00044787 | ||||||||
WBGene00219573 | ||||||||
WBGene00008302 | ||||||||
Transcript | C54D10.15 | |||||||
C54D10.8a.1 | ||||||||
C54D10.14a.1 | ||||||||
C54D10.13.1 | ||||||||
C54D10.7.1 | ||||||||
C54D10.6.1 | ||||||||
C54D10.5.1 | ||||||||
C54D10.21 | ||||||||
C54D10.14b.1 | ||||||||
C54D10.8b.1 | ||||||||
Pseudogene | C54D10.12 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |