WormBase Tree Display for Variation: WBVar02124574
expand all nodes | collapse all nodes | view schema
WBVar02124574 | Name | Public_name | WBVar02124574 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855497 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y79H2A | ||||
Flanking_sequences | TTCTTATTTTTTAACCAATTAATTTCATAA | TATCTCACGAGCAACACTGGAAAAAAAATT | ||||||
Mapping_target | Y79H2A | |||||||
Source_location | 225 | CHROMOSOME_III | 12016001 | 12029000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00043997 | ||||||
WBGene00000273 | ||||||||
WBGene00220214 | ||||||||
WBGene00013579 | ||||||||
Transcript | Y79H2A.2a.1 | |||||||
Y79H2A.2b.1 | ||||||||
Y79H2A.12.1 | ||||||||
Y79H2A.14 | ||||||||
Y79H2A.1a.1 | ||||||||
Y79H2A.1c.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |