WormBase Tree Display for Variation: WBVar02124137
expand all nodes | collapse all nodes | view schema
WBVar02124137 | Name | Public_name | WBVar02124137 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855060 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | ATACAAGTTTTTTTAGTCTTGGCCAGTCTT | AATCAAATATTCGAAGAAATCCCAACAAAT | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 17620001 | 17643000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023018 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00202229 | ||||||
WBGene00195165 | ||||||||
WBGene00010206 | ||||||||
WBGene00201191 | ||||||||
WBGene00199551 | ||||||||
WBGene00045501 | ||||||||
WBGene00010212 | ||||||||
WBGene00010209 | ||||||||
WBGene00045506 | ||||||||
WBGene00195682 | ||||||||
Transcript (9) | ||||||||
Pseudogene | F57G4.4 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |